Incorporation of Digoxigenin-dUTP into Plasmid Inserts Using PCR

1. Prepare a bulk reaction mix containing all the components listed below except plasmid.
[FINAL]                                                     2.5% Dig                                                             5.0% Dig
STOCK                                                             or amount                                               100 μl RXN                                                        100 μl RXN
dH2O                                                                       ó                                                                46.5 μl                                                                 46.4 μl
Taq Buffer (10X; Mg-free)                             1X                                                               10.0 μl                                                                 10.0 μl
MgCl2 (50 mM)1                                           2 mM                                                               4.0 μl                                                                    4.0 μl
Glycerol2                                                          15 %                                                              15.0 μl                                                                  15.0 μl
dNTP Mix-dTTP(10 mM each)               50 μM each                                       1.5 (0.5 μl each)                                              1.5 (0.5 μl each)
dTTP (10 mM)                                          48.75 or 47.5 μM                                    0.4875 μl                                                               0.475 μl
Dig-dUTP (1 mM)3                                    1.25 or 2.5 μM                                           0.125 μl                                                               0.250 μl
Taq Enzyme (5U/μl)1                                   2.0 U                                                              0.4 μl                                                                    0.4 μl
Primer 1 (2 μM)4 ,5                                       0.2 μM                                                        10.0 μl                                                                  10.0 μl
Primer 2 (2 μM)4,5                                        0.2 μM                                                        10.0 μl                                                                  10.0 μl
Plasmid (5 ng/μl)4                                           10 ng                                                            2.0 μl                                                                     2.0 μl

2. Add 98 μl of bulk mix into each tube.
3. Add 2 μl of plasmid to each tube. Mix briefly and centrifuge.
4. Overlay each sample with 50 μl of ultrapure mineral oil.
5. Place in PCR machine, making sure there is sufficient oil in each well to provide proper contact with tube.
6. Amplify using following program6 :
1 Cycle of:                                                       25 Cycles of:                                       1 Cycle of:
94•C for 1 min                                             94•C for 1 min                                 72•C for 4 min
55•C for 2 min
72•C for 2 min *
* Note: you may need to double the extension time for inserts longer than 1.5 Kb.
1 It may be necessary to determine optimal concentrations of MgCl2 and Taq with each new lot of enzyme.
2 This optional ingredient has been found to help amplify large or ìdifficultî inserts.
3 Digoxigenin-11dUTP, Boehringer Mannheim, Cat. # 1093088 (25 nmoles/25μl)
4 Diluted in DNA dilution buffer (10 mM Tris, pH 8.0, 1 mM EDTA, 10 mM NaCl).
5 Examples of primer sequences
pUC and M13                                             CV72                                             5í – ACGACGTTGTAAAACGACGGCCAGT – 3í
derived vectors                                       CV76                                              5í – AAACAGCTATGACCATGATTACGCC – 3í
pBR322 PstI                                              CV236                                            5í – GCGCAACGTTGTTGCCAT – 3í
inserts                                                         CV237                                            5í – CGAGCGTGACACCACGAT – 3í
6 Conditions optimized for ERICOMP TwinBlockô System thermocycler.

7. Remove oil by adding 25 μl TE + 50 μl chloroform. Mix and centrifuge. Pipet top aqueous layer into new
tube.
8. Quantify yield of insert using one of the three methods described in later sections: gel quantification,
fluorometry or spot fluorescence (see other protocols).
9. Gel quantification is a good choice since it also allows to check the amplification product and the incorporation
of Dig-dUTP into this product. Details on these protocols are given in the Gel Quantification section.

0

Add a Comment