Molecular Weight Markers for Gel Electrophoresis

NOTE: Two types of molecular weight (MW) standards are routinely used. The Lambda/HindIII and
PhiX174/HaeIII MW standards provide a useful reference for calculating molecular weights of large
and small DNA fragments, respectively, after electrophoretic separation; the ìinternal MW standardsî
provide a means for normalizing fragment migration distances within each lane to facilitate comparisons
between lanes on the same or different luminographs in fingerprinting studies.
END-LABELED LAMBDA (l) DNA AS A MOLECULAR WEIGHT
STANDARD FOR LUMINOGRAPHS:
DIGESTION OF   λ DNA WITH HINDIII:

STOCK                                                        [FINAL] or amount                                                  50 μl RXN
ddH2O                                                                       ó                                                                           31.8 μl
10X Buffer                                                              1X                                                                            5.0 μl
0.1 M Spermidine                                            2.5 mM                                                                      1.2 μl
l DNA (0.45 μg/μl)*                                           5 μg                                                                       11.0 μl
HindIII (10 U/μl)                                       2 U/μg DNA                                                                  1.0 μl
* Check the concentration of commercial l and adjust quantities accordingly.
1. Allow to digest at 37•C for 2-3 h.
2. Check that the digestion is complete by running about 50 ng on a 0.7% agarose gel. If it is OK, then move to
step 3 OR 4.
3. If you will use the digested l DNA as a MW marker without end-labeling it, then inactivate enzyme by
incubating at 65•C for 10 min. Then add 110 μl TE and 40 μl 5X SGB to bring to a concentration of 25 ng/μl.
Aliquot and keep at 4•C or in the freezer.
4. For end-labeling, precipitate by adding 5 μl of 2.5 M NaOAc and 125 μl of absolute EtOH, mix well by
inversion, and place at -80•C for 30 min.
5. Centrifuge in a microfuge for 10-15 min at full-speed. Pour off supernatant and invert tubes to drain. It is very
important to allow the pellet to dry.
6. Resuspend the pellet in 15 μl ddH2O. Assuming little or no DNA loss during precipitation, the concentration
should be about 5 μg/15 μl or 0.33 μg/μl.

END-LABELING OF  λ /HINDIII DNA WITH DIGOXIGENIN-dUTP (Dig-dUTP):

STOCK                                                                            [FINAL]or amount                                                              50 μl RXN
ddH2O                                                                                            ó                                                                                      25.0 μl
10X Klenow Buffer                                                                   1X                                                                                       5.0 μl
10 mM dATP                                                                           100 μM                                                                                0.5 μl
10 mM dCTP                                                                            100 μM                                                                                0.5 μl
10 mM dGTP                                                                            100 μM                                                                                0.5 μl
1 mM dig-dUTP                                                                         40 μM                                                                                 2.0 μl
l/HindIII DNA*                                                                           5 μg                                                                                 15.0 μl
2U/μl Klenow**                                                                           3 U                                                                                     1.5 μl
* Check the concentration of commercial l and adjust accordingly.
** Purchase from Fisher Scientific (cat. # PR-M2201 Promega-Biotec) or
BRL (cat. # 80125B)
7. Incubate at 37•C for 1.5 h.
8. Stop the reaction by placing at 65•C for 15 min.
9. EtOH precipitate as in (2) above.
10. Resuspend in 250 μl TE to bring to a final concentration of 20 ng/μl. This stock can then be diluted to 10 or 1
ng/μl with TE.
11. Verify incorporation of dig-dUTP following the protocol ìChecking the Activity of Incorporated DigoxigenindUTPî
(p. 24).
Use 5 ng/lane of l DNA digested with HindIII and end-labeled with digoxigenin-dUTP.
12. Prepare working solutions from the stocks based on the following proportions:
1 ng/μl                                                10 ng/μl                                                     20 ng/μl
STOCK                                                               STOCK                                                  STOCK                                                          STOCK

λDNA end labeled                                           5 μl                                                     0.50 μl                                                         0.25 μl
TE                                                                         11 μl                                                   15.50 μl                                                       15.75 μl
5X SGB                                                                  4 μl                                                     4.00 μl                                                         4.00 μl
DIGESTION OF ØX174 DNA WITH HAEIII:
[FINAL]
STOCK                                                                                  or amount                                                         150 μl RXN
ddH2O                                                                                           ó                                                                      68.25 μl
10X Buffer                                                                                  1X                                                                     15.00 μl
0.1 M Spermidi ne                                                             2.5 mM                                                                   3.75 μl
fX174 DNA (0.25 μg/μl)*                                                 15 μg                                                                  60.00 μl
HaeIII (10 U/μl)                                                           2 U/μg DNA                                                               3.00 μl
* Check the concentration of commercial fX174RF plasmid DNA and adjust quantities
accordingly.
1. Allow to digest at 37•C for 2-3 h.
2. Check that the digestion is complete by running about 50 ng on a 0.7% agarose gel.
3. Inactivate enzyme by incubating at 65•C for 10 min. Then add 300 μl TE and 150 μl 5X SGB to bring to a
concentration of 25 ng/μl. Aliquot (200 μl per 0.5 ml tubes) and keep at 4•C or in the freezer.

INTERNAL MOLECULAR WEIGHT MARKERS FOR
FINGERPRINTING WITH RFLPS
NOTE: Two markers, a ìtopî and a ìbottomî l DNA fragments, are used routinely as internal MW standards in
each and every lane of a fingerprinting gel, including the MW marker lane(s). They were chosen on
account of their easy preparation and detection, as well as their convenient size for normalization
purposes in most fingerprinting experiments using RFLPs.
PREPARATION OF A “TOP MW STANDARD”
1. Digest l DNA with XbaI to generate 2 large fragments (24.5 and 24 kb) that will comigrate after the short
migrations used in these protocols (see for example the next protocol).
[FINAL]
STOCK                                                                             or amount                                                                50 μl RXN
ddH2O                                                                                                                                                                     30.3 μl
10X Buffer                                                                             1X                                                                              5.0 μl
0.1 M Spermidine                                                        2.5 mM                                                                           1.2 μl
l DNA (0.4 μg/μl)*                                                            5 μg                                                                          12.5 μl
XbaI (10 U/μl)                                                                 2 U/μg                                                               DNA 1.0 μl
* Check the concentration of commercial l and adjust quantities accordingly.
2. Allow to digest at 37•C for 1-2 h. Verify the digestion by running a small sample (say 0.5 μl) in a 0.7 %
agarose micro gel. Add more enzyme to digestion reaction and incubate for another hour if need be.
3. Precipitate by adding 5 μl of 2.5 M NaOAc and 125 μl of absolute EtOH, mix well by inversion, and place at –
80•C for 30 min.
4. Centrifuge in a microfuge for 10-15 min at full-speed. Pour off supernatant and invert tubes to drain. It is very
important to allow the pellet to dry.
5. Resuspend the pellet in 500 μl ddH2O. Assuming little or no DNA loss during precipitation, the concentration
should be about 10 ng/μl. This amount will be enough for at least 150 gels with 120 wells each.
ISOLATION AND PREPARATION OF A “BOTTOM MW STANDARD”
NOTES: A l-EcoRI/KpnI 1.5 kb fragment was cloned in pUC18 (2686 bp) and is available upon request. It
was originally isolated by digesting l with EcoRI and BamHI.
You can obtain large amounts of this fragment from plasmid minipreps as described elsewhere (p.
34). Since it is important to obtain a very ‘clean’ fragment, treat the resulting DNA with
Proteinase K at 37•C for 30 min, then perform a phenol/chloroform extraction followed by a back
extraction to minimize losses of DNA, and finally EtOH precipitate before resuspending in TE.
6. Digest 10 μg of the plasmid-containing DNA in a 30 μl reaction with 2 units each of EcoRI and BamHI (same
buffer).
7. Check digestion by loading 1 μl (i.e., about 300 ng) on a minigel.
8. If the digestion is complete, add 6 μl of 5X SGB and load on a 1.2% low melting point (LMP) agarose gel.
You can load up to 5 μg/lane (load in 2 to 4 wells). Include EtBr in the gel and running buffer.
9. Run the gel in the cold room at 40 mA. Check separation with portable UV lamp after 30 min (if running in a
minigel).
10. When plasmid and insert are well separated, take out the insert either by cutting it out or by electroelution of
the l fragment onto DEAE-cellulose membrane (e.g., S&S NA-45).

11. Adjust to a final concentration of 10 ng/μl. If you have cut the fragment out, melt the gel at 65•C before
adding TE to adjust the concentration.
Remember that 10 μg plasmid DNA will yield 3.5 μg insert DNA.
12. Check on a minigel (50-100 ng are enough for this purpose).
Use 0.25 ng/lane of the 24.5 kb lambda fragment, and 0.50 ng/lane of the 1.5 kb one, and detect by
using 500 ng of labeled l DNA per large hybridization bottle (see p. 28). Label l by randompriming
including 1% digoxigenin-dUTP (see p. 21).
ADDITION OF INTERNAL MW STANDARDS TO PLANT GENOMIC DNA
NOTE: The appropriate quantities of internal standards should be added to each genomic DNA for
fingerprinting analysis. The easiest procedure consists of adding these when resuspending the
DNA’s after restriction digestion (p. 6).
13. Prepare a working bulk of the fragments according to the following:
amount to add per single gel lane
Fragment                                                  [Stock]                           ng/lane                                μl stock/lane
24.5 kb                                                     10 ng/μl                          0.25 ng                                    0.025 μl
1.5 kb                                                        10 ng/μl                          0.50 ng                                   0.050 μl
Do not forget to add the right amount of 5X SGB to complete the loading mixture of DNA, TE, and internal
MW standards.
INTERNAL MOLECULAR WEIGHT MARKERS FOR
FINGERPRINTING WITH SSRS
NOTE: A “top” molecular weight standard is routinely used in every lane of SSR fingerprinting gels,
both agarose and polyacrylamide. It is PCR amplified from the Phi plasmid (fX174RF) and simple to
prepare. A “bottom” fragment is not possible to use, since fragments smaller than about 80 base
pairs show up in both agarose and polyacrylamide gels as a smear, if they show up at all. Larger
“bottom” standards would interfere with the SSR alleles themselves, which can often be as small as
80 – 100 base pairs.
1. Obtain the following primers from any source that manufactures oligonucleotides (we
frequently use Operon for this purpose);
Forward primer (5’-3’): CGCCAAATGACGACTTCTAC
Reverse primer (5’-3’): GCGCATAACGATACCACTGA
These primers correspond to position 1547 and 2050, respectively, of the Phi plasmid, and amplify a

fragment 523 base pairs in length.

2. Run the following PCR reaction using uncut Phi (fX174RF) plasmid DNA. We recommend you
do several reactions, as you will need a lot of product.
[FINAL]
STOCK                                                                        or amount                                   25 μl RXN                                               100 μl RXN
ddH2O                                                                                 —                                               10.3 μl                                                        41.2 μl
10X Taq buffer                                                                1X                                                 2.5 μl                                                       10.0 μl
dNTP (2.5mM each)                                           50 mM each                                       0.5 μl                                                          2.0 μl
MgCl2 (50 mM)                                                         1.2 mM                                            0.6 μl                                                           2.4 μl
Taq polymerase (5U/μl)                                         0.5 U                                               0.1 μl                                                           0.4 μl
Phi DNA (5 ng/μl)                                                       25 ng                                              5.0 μl                                                        20.0 μl
Forward primer (2.0 μM)                                     0.24 μM                                           3.0 μl                                                         12.0 μl
Reverse primer (2.0 μM)                                      0.24 μM                                           3.0 μl                                                         12.0 μl
3. Amplify using the following program:
1 Cycle of:                                                            30 Cycles of:                                                  1 Cycle of:
93°C for 1 min                                                  93°C for 30 sec                                             72°C for 5 min
62°C for 1 min
72°C for 1 min
4. Run a minigel to check for amplification and correct size on some of the reactions; if there has
been amplification of a single, 523 bp fragment, combine all the reactions into one tube for
storage.
5. Use about 200 ng of molecular weight standard in each lane of a polyacrylamide fingerprinting
gel; you can add it directly to the reaction mixture with the loading buffer

0

Add a Comment